pgem-easy vector cloning kit Search Results


system i kit  (TaKaRa)
99
TaKaRa system i kit
System I Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/system i kit/product/TaKaRa
Average 99 stars, based on 1 article reviews
system i kit - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier
pgem ® -t easy vector systems kit  (Promega)
90
Promega pgem ® -t easy vector systems kit
Pgem ® T Easy Vector Systems Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem ® -t easy vector systems kit/product/Promega
Average 90 stars, based on 1 article reviews
pgem ® -t easy vector systems kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pgem-t easy vector  (Promega)
90
Promega pgem-t easy vector
Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem-t easy vector/product/Promega
Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pgems-t easy vector system kit  (Promega)
90
Promega pgems-t easy vector system kit
Pgems T Easy Vector System Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgems-t easy vector system kit/product/Promega
Average 90 stars, based on 1 article reviews
pgems-t easy vector system kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pgem t easy vector cloning kit  (Thermo Fisher)
86
Thermo Fisher pgem t easy vector cloning kit
Pgem T Easy Vector Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem t easy vector cloning kit/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
pgem t easy vector cloning kit - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier
cloning kit  (Promega)
90
Promega cloning kit
Cloning Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cloning kit/product/Promega
Average 90 stars, based on 1 article reviews
cloning kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pgem-t-easy kit  (Promega)
90
Promega pgem-t-easy kit
Pgem T Easy Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem-t-easy kit/product/Promega
Average 90 stars, based on 1 article reviews
pgem-t-easy kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing  (Qiagen)
96
Qiagen dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing
KEY RESOURCES TABLE
Dnase Set Qiagen 79254 Pgem T Easy Vector System Promega A1360 Deposited Data Pigeon Whole Genome Sequencing, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing/product/Qiagen
Average 96 stars, based on 1 article reviews
dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier
ta cloning kit (pgem-t easy vector system  (Promega)
90
Promega ta cloning kit (pgem-t easy vector system
KEY RESOURCES TABLE
Ta Cloning Kit (Pgem T Easy Vector System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ta cloning kit (pgem-t easy vector system/product/Promega
Average 90 stars, based on 1 article reviews
ta cloning kit (pgem-t easy vector system - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pgem-t easy vector plasmid cloning kit  (Promega)
90
Promega pgem-t easy vector plasmid cloning kit
KEY RESOURCES TABLE
Pgem T Easy Vector Plasmid Cloning Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem-t easy vector plasmid cloning kit/product/Promega
Average 90 stars, based on 1 article reviews
pgem-t easy vector plasmid cloning kit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
pgem t easy cloning vector  (tiangen biotech co)
90
tiangen biotech co pgem t easy cloning vector
KEY RESOURCES TABLE
Pgem T Easy Cloning Vector, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem t easy cloning vector/product/tiangen biotech co
Average 90 stars, based on 1 article reviews
pgem t easy cloning vector - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
quikchange lightning kits  (Agilent technologies)
90
Agilent technologies quikchange lightning kits
KEY RESOURCES TABLE
Quikchange Lightning Kits, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quikchange lightning kits/product/Agilent technologies
Average 90 stars, based on 1 article reviews
quikchange lightning kits - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Current biology : CB

Article Title: A ROR2 coding variant is associated with craniofacial variation in domestic pigeons

doi: 10.1016/j.cub.2021.08.068

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays DNeasy Blood and Tissue Kit Qiagen 69504 RNAlater ThermoFisher Scientific AM7021 RNeasy Mini Kit Qiagen 74004 RNase-Free DNAse Set Qiagen 79254 pGEM-T Easy Vector System Promega A1360 Deposited Data Pigeon whole genome sequencing and pigeon embryonic craniofacial RNA-sequencing datasets NCBI SRA database PRJNA680754, PRJNA513877 Vertebrate ROR2 and invertebrate ROR homolog amino acid sequences Ensembl ( ensembl.org ) and NCBI ( ncbi.nlm.nih.gov/gene ) Experimental Models: Organisms/Strains Columba livia Shapiro Lab loft, Utah Pigeon Club, various pigeon breeders Oligonucleotides ROR2-forward GGAACCGACAGGTTCTACCA ROR2-reverse TGCTTCGTCCATCTGAAGTG WNT5A-forward CATAGTGGCTCTGGCCATTT WNT5A-reverse CCCCGACTGTTGAGTTTCAT Software and Algorithms ImageJ v1.52q https://imagej.nih.gov/ij/ Amira v6.5.0 ThermoFisher Scientific i3D Converter v3.80 IDAV Landmark Editor v3.0 UC Davis FastQC Babraham Bioinformatics Cutadapt [ 54 ] Bowtie2 [ 56 ] Stacks v2.52 [ 57 ][ 58 ] R/qtl v1.46-2 [ 67 ] msa v1.18.0 [ 61 ] geomorph v3.3.1 [ 63 ][ 64 ][ 65 ] R v3.6.3 [ 66 ] Morpho v2.8 https://github.com/zarquon42b/Morpho ggplot2 v3.3.0 [ 53 ] gggenes v0.4.0 https://github.com/wilkox/gggenes FastQForward [ 68 ] VCFLIB GPAT++ toolkit github.com/vcflib VAAST2 [ 36 ] STAR v2.5.0a [ 74 ] Subread featureCounts v1.5.1 [ 75 ] Salmon v1.5.1 [ 76 ] DESeq2 v1.12.4 [ 77 ] Open in a separate window KEY RESOURCES TABLE

Techniques: Plasmid Preparation, Sequencing, Software